Impairment of uterine smooth muscle contractions and prostaglandin secretion from cattle myometrium and corpus luteum in vitro is influenced by DDT, DDE and HCH
Introduction
1,1,1-Trichloro-2,2,-bis-4-chlorophenyl-ethane (DDT) and γ-hexachlorocyclohexane (HCH), which is commonly referred to as lindane, are recognized as representative organochlorine pesticides from the group of endocrine disruptors. DDT and HCH are currently used in agriculture and forestry in developing countries of Africa and Asia to control pests of crops and to overcome typhoid, malaria (Gunasekaran et al., 2005, Rogan and Chen, 2005, Nweke and Sanders, 2009, Hlongwana et al., 2013) or scabies (Ngueleu et al., 2013). Because of their widespread distribution, lipophilic properties and high resistance to biodegradation (Rogan and Chen, 2005, Tsai, 2010), DDT and HCH are still detected in fodder plants (Pazou et al., 2013) and in the bodies of farm animals (Kamarianos et al., 2003) and humans (Toft et al., 2004, Llop et al., 2010). The production and use of DDT and HCH are banned in the USA, Japan and many European countries (Fromberg et al., 1999, Glynn et al., 2000, Li et al., 2006). However, due to the ability of DDT and HCH to spread by air and water, these pesticides are also a problem in places far from the sources of application (Glynn et al., 2000, Ayotte et al., 2001, Burns et al., 2013). In the environment, DDT is degraded to bis 4-chlorophenyl-1,1-dichloroethene (DDE), which is a stable and ubiquitous component and is also found in living tissues (Turusov et al., 2002, Kamarianos et al., 2003, Meeker et al., 2009). When these pesticides enter organisms, they can act as endocrine disruptors and compete as agonists or antagonists with more than one type of nuclear steroid receptors (Kuiper et al., 1998, Turusov et al., 2002, Li et al., 2008). Therefore, there is increasing concern that pesticides may cause an impairment in the endocrine system, followed by alterations in reproductive physiology.
The unaffected regulation of uterine motility is one of the crucial factors for the initiation and maintenance of pregnancy. Prostaglandins (PGs) are a group of important regulators of the reproductive process, including contractile activity of the myometrium. PGF2α mediates the stimulation of myometrial contractions, but PGE2 and PGI2 can cause the excitation or relaxation of the myometrium (Senior et al., 1993, Coleman et al., 1994). However, the initiation of uterine contractions and/or labor after PGE2 induction may be a result of cervical ripening rather than its direct myometrial effect (Chiossi et al., 2012). The positive feedback loop between luteal oxytocin (OT) and uterine PGF2α in cow is well documented (Skarzynski et al., 1997, Kotwica et al., 1999). However, it has also been reported that LIF, which plays an important role in mammalian implantation, enhances PGE2 production and expression for its uterine receptors (Horita et al., 2007).
Epidemiological observations in humans show a correlation between the presence of DDT, its metabolite (DDE) or HCH in the blood of mothers and an increased risk of miscarriages (Gerhard et al., 1998, Korrick et al., 2001, Longnecker et al., 2005, Venners et al., 2005) and preterm deliveries (Saxena et al., 1980, Longnecker et al., 2001, Torres-Arreola et al., 2003, Pathak et al., 2010, Mustafa et al., 2013). However, data from other studies did not confirm these observations (Berkowitz et al., 1996, Farhang et al., 2005; Fenster et al., 2006; Wood et al., 2007, Cioroiu et al., 2010). In our in vitro study, we showed that DDT and DDE affect the endometrial secretion of PGF2α and PGE2 (M. Wrobel et al., 2009), which are natural regulators of uterine contractions (Senior et al., 1993, Coleman et al., 1994). Because PG secretion could also be followed by the stimulation of myometrial contractions in pregnant cows by these compounds (Mlynarczuk et al., 2010) and because the endometrium is a main source of PGs in the reproductive tract, the involvement of the secreted PGs from the myometrium and corpus luteum (CL) in the adverse effects of organochlorined pesticides on myometrial contractions should be investigated.
Therefore, the aim of this study was to determine the effect of DDT, DDE and HCH on (a) uterine smooth muscle contractions and (b) the synthesis and secretion of PGF2α, PGE2 and PGI2 from myometrial and luteal cells.
Section snippets
Animals and tissues collection
Uterine horns and CL from healthy cows and mature heifers on days 8–12 of the estrous cycle (Ireland et al., 1980, Fields and Fields, 1996) were collected in a commercial slaughterhouse within 20 min after slaughter. These tissues were placed in ice-cold saline and transported to the laboratory within 1 h. Each medium used was supplemented with gentamycin (20 μl/ml). All materials used in these studies were purchased from Sigma-Aldrich (PL) unless otherwise stated.
Uterine strip preparation and incubation
To measure the uterine
Results
Neither myometrial (Fig. 1A) nor luteal (Fig. 1B) cell viability was affected by HCH (P>0.05), in contrast to Act D (P<0.001). Compared to the control, DDT, DDE and HCH increased (P<0.05) the force of contractions with DDE having the greater effect (Fig. 2). All studied xenobiotics increased (P<0.05) the secretion of PGF2α, PGE2 and PGI2 from the myometrium (Fig. 3) compared to the control. Moreover, DDT and DDE increased (P<0.05) PGF2α secretion (Fig. 4A), and HCH increased (P<0.05) the
Discussion
The viability of both myometrial and luteal cells was not affected by HCH exposure. Because DDT and DDE do not affect the lifespan of bovine uterine and ovarian cells at the same used dose (M. Wrobel et al., 2009), we assume that the observed changes in the function of the myometrium and CL were not evoked by cytotoxic effects of these applied compounds.
All tested xenobiotics increased the force of myometrial contractions with DDE exerting the greatest effect. Similarly, DDE, to a greater
Conclusion
Prostaglandins are involved in the mechanism of DDT, DDE and HCH adverse effect on myometrial contractions in cow.
Conflict of interest
The authors declare that there are no conflicts of interest.
Acknowledgments
We would like to thank Professor W.J. Silvia (University of Kentucky, Lexington, KY, USA) and Professor W.W. Thatcher (University of Florida, Gainesville, FL, USA) for the PGFM and PGE2 antisera, respectively. This study was supported by National Science Centre (N N311 082140) and by the Polish Academy of Sciences (ZFiTR/2011).
References (76)
- et al.
Organochlorine pesticides in colostrums in case of normal and preterm labor (Iasi, Romania)
Sci. Total Environ.
(2010) - et al.
Lindane-induced inhibition of spontaneous contractions of pregnant rat uterus
Reprod. Toxicol.
(1999) - et al.
Morphological characteristic of the bovine corpus luteum during the estrous cycle and pregnancy
Theriogenology
(1996) - et al.
Expression of enzymes of cyclooxygenase pathway and secretion of prostaglandin E2 and F2alpha by porcine myometrium during luteolysis and early pregnancy
Theriogenology
(2006) - et al.
Review on persistent organic pollutants in the environment of Greenland and Faroe Islands
Chemosphere
(1999) - et al.
Accuracy of predicting stages of bovine estrous cycle by gross appearance of the corpus luteum
J. Dairy Sci.
(1980) - et al.
Investigation of the role of estrogenic action and prostaglandin E2 in DDT-stimulated rat uterine contractions ex vivo
Toxicology
(1992) - et al.
DDD chlorinated insecticide 1,1-dichloro-2,2-bis(4-chlorophenyl)ethane (p,p′-DDD) increases intracellular calcium in rat myometrial smooth muscle cells
Toxicol. Appl. Pharmacol.
(1995) - et al.
Characterization of o,p′-DDT-stimulated contraction frequency in rat uterus in vitro
Fundam. Appl. Toxicol.
(1991) - et al.
Association of DDT with spontaneous abortion: a case-control study
Ann. Epidemiol.
(2001)
The concentrations of catecholamines and oxytocin receptors in the oviduct and its contractile activity in cows during the estrous cycle
Theriogenology
Oxytocin modulates the pulsatile secretion of prostaglandin F2alpha in initiated luteolysis in cattle
Res. Vet. Sci.
in vitro profiling of the endocrine disrupting potency of organochlorine pesticides
Toxicol. Lett.
Dichlorodiphenyltrichloroethane usage in the former Soviet Union
Sci. Total Environ.
Concentrations and determinants of organochlorine levels among pregnant women in Eastern Spain
Sci. Total Environ.
Maternal serum level of the DDT metabolite DDE in relation to fetal loss in previous pregnancies
Environ. Res.
Association between maternal serum concentration of the DDT metabolite DDE and preterm and small-for-gestational-age babies at birth
Lancet
Improvement of radioimmunoassays for prostaglandins in bovine blood plasma and their application to monitor reproductive functions
Theriogenology
Effect of environmental pollutants on oxytocin synthesis and secretion from corpus luteum and on contractions of uterus from pregnant cows
Toxicol. Appl. Pharmacol.
Effect of natural particles on the transport of lindane in saturated porous media: laboratory experiments and model-based analysis
J. Contam. Hydrol.
Forskolin-induced cyclic AMP signaling in single adherent bovine oviductal cells: effect of dichlorodiphenyltrichloroethane (DDT) and tris(4-chlorophenyl)methanol (TCPM)
Toxicol. in vitro
Organochlorine compounds in mother and fetus during labor
Environ. Res.
Identification of optimal housekeeping genes for examination of gene expression in bovine corpus luteum
Reprod. Biol.
Health risks and benefits of bis(4-chlophenyl)-1,1,1-trichloroethane (DDT)
Lancet
Role of chlorinated hydrocarbon pesticides in abortions and premature labour
Toxicology
Changes in ovarian oxytocin secretion as an indicator of corpus luteum response to prostaglandin F2a treatment in cattle
Theriogenology
The effect of ovarian steroids on oxytocin-stimulated secretion and synthesis of prostaglandins in bovine myometrial cells
Prostaglandins Other Lipid Mediat.
Epidemiological evidence on reproductive effects of persistent organochlorines in humans
Reprod. Toxicol.
Preterm birth in relation to maternal organochlorine serum levels
Ann. Epidemiol.
Congener-specific effects of PCBs on contractions of pregnant rat uteri
Reprod. Toxicol.
Phospholipase-mediated inhibition of spontaneous oscillatory uterine contractions by lindane in vitro
Toxicol. Appl. Pharmacol.
The adverse effect of dichlorodiphenyltrichloroethane (DDT) and its metabolite (DDE) on the secretion of prostaglandins and oxytocin in bovine cultured ovarian and endometrial cells
Reprod. Toxicol.
The effect of DDT and its metabolite (DDE) on prostaglandin secretion from epithelial cells and on contractions of the smooth muscle of the bovine oviduct in vitro
Toxicol. Appl. Pharmacol.
Involvement of prostaglandin F2α in the adverse effect of PCB 77 on the force of contractions of bovine myometrium
Toxicology
DDT spraying for malaria control and reproductive function in Mexican men
Epidemiology
Stimulation of pregnant rat uterine contraction by the polychlorinated biphenyl (PCB) mixture Aroclor 1242 may be mediated by arachidonic acid release throught activation of phospholipase A2 enzymes
J. Pharmacol. Exp. Ther.
Stimulation of contraction of pregnant rat uterus in vitro by non-dechlorinated and microbially dechlorinated mixtures of polychlorinated biphenyls
Environ. Health Perspect.
The role of DDE and polychlorinated biphenyl levels in preterm birth
Arch. Environ. Contam. Toxicol.
Cited by (19)
Do commonly used herbicides (atrazine and glyphosate) have the potential to impair the contractions, prostaglandin releasing and conducting of oxytocin signal at the bovine cervix in vitro?
2022, TheriogenologyCitation Excerpt :KRS was maintained at 38 °C and oxygenated (95% O2 and 5% CO2). All preparations were allowed to equilibrate for 2 h. Subsequently, the forces of the spontaneous isometric contractions of smooth muscle were measured every 2 s for 20 min as described previously [40]. After incubation, the medium was removed, and the cells were covered with Phenozol (300 μl for each well; A&A Biotechnology, PL).
Chloroorganic (DDT) and organophosphate (malathion) insecticides impair the motor function of the bovine cervix
2021, Toxicology and Applied PharmacologyThe effect of polychlorinated biphenyls (PCBs) on bovine oviductal contractions and LIF synthesis during estrous cycle, in vitro studies
2020, Research in Veterinary ScienceCitation Excerpt :Total RNA (0.5 μg for each sample) was reverse transcribed (42 °C for 1 h) using reverse transcriptase. The primer sequences (LIF – studied gene: Accession no. NM_173931.1, Product size: 160; Forward: TCTTGGCGGCAGGAGTTG; Reverse: GTTGAGTTGTCCCAGCTGGTTT; Wrobel et al., 2014; TBP - housekeeping gene: Accession no. NM_001075742; Product size: 194; Forward: CAGAGAGCTCCGGGATCGT; Reverse: ACACCATCTTCCCAGAACTGAATAT; Rekawiecki et al., 2013), were synthesized (IBB PAN PL). Real-time PCR (25 μl volume) was performed using the APB Prism 7900 sequence detection system (Applied Biosystems, USA).
Effect of neonatal exposure to endosulfan on myometrial adaptation during early pregnancy and labor in rats
2019, Molecular and Cellular Endocrinology